Rancangan Primer Untuk Aplikasi Gen Pengkode Kitinase dari Bacillus Substillis

Mardiyanto Mardiyanto, Setiawan Yusuf

Abstract


Telah dilakukan penelitian tentang perancangan primer untuk aplifikasi gen pengkode kitinase dari Bacillus substillis. Hasil perancangan dan amplifikasi akan dipergunakan untuk proses overproduksi kitinase yang akan dimanfaatkan pada bidang kesehatan dan pertanian. Dari proses perancangan diketahui bahwa gen pengkode kitinase dari Bacillus substillus ditemudi cds tidak dimulai dari basa pertama dan ada 186 basa dihitung dari strat kodon, primer yang dihasilkan tidak memperlihatkan empat basa yang berurutan menempel pada kondisi self dimmer ataupun hair pin loop. Urutan primer yang siperoleh adalah Forward aaaagggggtgaacaaaatagagt dan Revearese acacggtcgtcgtcagcaagta


Full Text:

PDF

Refbacks

  • There are currently no refbacks.


  

 

Creative Commons License

Jurnal Penelitian Sains (JPS) Published by UP2M, Faculty of Mathematic and Natural Science Sriwijaya University is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License.

 

View My Stats